GABRILA65162183544miv_Superinteressante Created with Sketch.

Brasileiros encontram genes responsáveis pela produção de açúcar na cana

Equipe da Unicamp usou técnica inovadora para navegar no complicado DNA da planta e chegar ao trecho-chave – o que pode gerar um aumento na produtividade

Se você já tentou encarar um livrão como Guerra e Paz e se desanimou com as 1,3 mil páginas de realismo russo, nem tente ler o DNA da cana-de-açúcar. O dito cujo tem 10 bilhões de pares de bases – isto é, de letras de DNA. Se você imprimir tudo em Times New Roman, tamanho 12, espaçamento 1,15, terá em mãos 4,3 milhões de folhas de papel A4. As 32 mil páginas da Encyclopædia Britannica não chegam nem aos pés.

Ler Tolstói, para muitos acadêmicos, é um trabalho de anos. Ler o genoma da cana-de-açúcar, também. Ela é uma das commodities mais importantes da economia brasileira. Na última safra, foram produzidas 657,2 milhões de toneladas – a Índia, segundo lugar mundial, comeu poeira. Conhecer esse vegetal de perto – perto mesmo, em escala molecular – pode abrir caminho para ajustes genéticos finos que aumentem sua produtividade e sua resistência a doenças.

Em 28 de março, Anete Pereira de Souza, geneticista da Universidade Estadual de Campinas (Unicamp), deu um passo inédito nesse caminho: em um artigo científico, assinado em parceria com quatro colegas, ela usou uma técnica inovadora para identificar um longo trecho de DNA da cana que é muito importante na produção de açúcar. Com essa informação em mãos, fica muito mais fácil buscar variedades novas e mais doces do vegetal sem dar tiros no escuro. 

Revisão rápida: as informações necessárias para construir e operar os seres vivos estão armazenadas em longas cadeias de componentes químicos (as tais bases nitrogenadas, para que gosta de jargão) chamados adenina, tiamina, citosina e guanina. Para facilitar, eles são identificados pela primeira letra de seus nomes – A, T, C e G. Você já deve ter em mente a imagem clássica da molécula de DNA: uma escadinha espiralada. Uma representação digital dele, porém – que leva em conta só a informação, e não a estrutura química – é algo mais ou menos assim: “ATCGGGTTTCGTCGAACAGTCTG etc.”

No quesito tamanho, o DNA da cana, com seus 10 bilhões de letrinhas, dá um baile no ser humano, que tem “só” 3,2 bilhões. É bom deixar claro que um DNA comprido não é sinônimo de organismo mais ou menos complexo. O genoma conta a história evolutiva da espécie, mas seu tamanho em bits não tem, necessariamente, relação com o tamanho ou a inteligência do ser que o carrega. Para entender a estratégia que a equipe brasileira usou para driblar o DNA extra-grande do vegetal – e chegar aos genes que mais interessam –, o primeiro passo é entender como a cana se tornou essa verdadeira enciclopédia. 

Breve história da cachaça

O genoma da cana-de-açúcar pode até ter tamanho de Tolstói, mas seu método de escrita está mais próximo do usado na Bíblia: capítulos fragmentados, contribuições apócrifas, revisões irresponsáveis e muitos, muitos anos de história. O vegetal é nativo das florestas úmidas do sudeste asiático. De acordo com o biólogo Jared Diamond, o mais provável é que tenha sido domesticado pelos nativos da ilha de Nova Guiné, a norte da Austrália, pouco depois de 7 mil a.C. – a data exata é incalculável.

Essa cana-de-açúcar raíz, de nome científico Saccharum officinarum, já veio de fábrica com um DNA nada simples. Ele é octaploide, isto é: há incríveis oito cópias de cada cromossomo no núcleo das células, em vez das duas presentes em humanos (nós somos diplóides). No total, são 80 cromossomos.

Foi esse o vegetal açucarado cultivado pelos colonizadores europeus nas Américas. Após séculos de plantation, porém, ele se tornou frágil. Da mesma forma que cãezinhos de raça, que sofrem com problemas congênitos por serem fruto do cruzamento frequente parentes próximos, a queridinha dos engenhos foi submetida a uma seleção artificial tão intensa que se tornou alvo fácil de pragas agrícolas.

A solução foi cruzá-la com uma espécie próxima, o capim indiano Saccharum spontaneum – grama-de-Kans –, que alcança três metros de altura e tem fibra para dar e vender. Era uma espécie mais acostumada à vida dura do campo. Seus genes forneceram uma resistência inédita à cana-de-açúcar, que passou a ser uma espécie híbrida (como uma mula, que surge do cruzamento de um asno com uma égua) e foi rebatizada de Saccharum hybridum. A cana original ainda existe, que fique claro – só não é mais explorada comercialmente.

O híbrido de capim e cana era forte feito um tanque, mas não tinha tanto açúcar assim. Para torná-lo um bocadinho mais próximo da cana que do capim, começou um longo processo de melhoramento, que envolveu cruzamentos sucessivos com a boa e velha S. officinarum. O resultado, visto por fora, foi uma espécie feita sob medida para as necessidades humanas. No núcleo da célula, porém, o DNA ficou uma bagunça: hoje, a cana contém qualquer coisa entre 100 e 130 cromossomos: tudo depende de qual proporção do genoma, exatamente, ela herda de cada um dos pais.

DNA não é documento

Muitas outras plantas domésticas têm genomas complexos por causa de cruzamentos selecionados. Vide o trigo comum (T. aestivum), que herdou seus cromossomos, organizados em múltiplos de seis, de uma mistura de três espécies chamadas T. urartu, a A. tauschii e a A. Speltoides. Isso não é, porém, exclusividade da agricultura. “O número de cromossomos independe da planta ser domesticada”, explicou Anete Pereira de Souza à SUPER. “O processo natural de evolução das plantas envolve cruzamento com plantas aparentadas. Isso pode acontecer eventualmente. É inclusive uma maneira de aparecerem outras espécies.”

Em uma situação dessas, ler o genoma de cabo a rabo e depois montar o quebra-cabeças é quase inviável. Só o servidor do Google dá conta de processar tanta informação. Para navegar pelo material genético e encontrar genes específicos, o jeito é apelar para comparações. A cana-de-açúcar, como quase tudo nesse mundo, tem família. Espécies próximas tendem a compartilhar longos trechos de DNA – vide os 98% de material genético do chimpanzé que também são parte do ser humano. O “primo chimpanzé” da cana é um vegetal chamado sorgo. Ele tem um DNA bem mais conciso e fácil de ler que o de sua prima (mais de dez vezes menor), por isso, já se sabe desde 2010 quais genes são responsáveis pela produção de açúcar no dito cujo. 

Os genes que tem uma função específica em um ser vivo tendem a fazer coisas parecidas nos seres vivos próximos. O truque de Souza e sua equipe, de maneira muito simplificada, foi pegar o código da região responsável pelo açúcar no sorgo e buscar uma sequência de letrinhas muito parecida na cana. Bingo. Ela estava lá.

É claro que “estava lá” não faz jus à complexidade da coisa: as 500 mil letrinhas de produção de açúcar do sorgo se traduziram em 1,2 milhão na cana. O segundo detalhe é que genes, ao contrário do que está no imaginário popular, não são botões de liga e desliga que podem ser ativados no laboratório na hora em que se bem entende. Um gene age sobre organismo produzindo uma proteína. Ponto. Essa proteína desencadeia uma longa série de reações bioquímicas e interage com as proteínas de incontáveis outros genes para só então se manifestar de maneira visível para quem vê de fora – aumentando, por exemplo, a produção de açúcar.

Em resumo, não há um gene do açúcar, mas centenas deles, todos importantes em maior ou menor grau. A planta é um organismo único, não um painel com diferentes alavancas. Daqui para frente, é preciso usar a genética para criar novas variedades de cana com cada vez mais inteligência. Cruzar exemplares com atenção para a maneira como seus DNAs irão se combinar nas plantas-filhas e até, quem sabe, usar engenharia genética para dar retoques aqui e ali. Pensou que plantar era fácil?

Comentários
Deixe um comentário

Olá, ( log out )

* A Abril não detém qualquer responsabilidade sobre os comentários postados abaixo, sendo certo que tais comentários não representam a opinião da Abril. Referidos comentários são de integral e exclusiva responsabilidade dos usuários que escreveram os respectivos comentários.

Preencha os seus dados abaixo ou clique em um ícone para log in:

Logotipo do WordPress.com

Você está comentando utilizando sua conta WordPress.com. Sair /  Alterar )

Foto do Google+

Você está comentando utilizando sua conta Google+. Sair /  Alterar )

Imagem do Twitter

Você está comentando utilizando sua conta Twitter. Sair /  Alterar )

Foto do Facebook

Você está comentando utilizando sua conta Facebook. Sair /  Alterar )

w

Conectando a %s